Marker Symbol: Ctbp1 | MGI:1201685

History
Genomic Position

Assembly: GRCm38

Chromosome: 5

Strand -

Mutation Details

Mutation method: Targeted Mutation

Mutation type: Point Mutation

Mutation subtype: Point Mutation
LoxP

Backbone:

Molecular Co-Ordinates
Feature Start End
Homology Arm
Genbank Files
Oligos Details
Sequence

ACCAGCTGGAAGTACCAGTACAGGGGACGACAGGCGCCACAGTTGGCTTA
TTACAGAATATGGTGCCCTCTTAGAGGCTAGCCCTGCCACTGAATTCATA
ACTTCGTATAGCATACATTATACGAAGTTATCCCAATCTAATGTGGATAT
ATTTGTTAATGTGGATGC

Wildtype Oligos Sequence

ACCAGCTGGAAGTACCAGTACAGGGGACGACAGGCGCCACAGTTGGCTTA
TTACAGAATATGGTGCCCTCTTAGAGGCTAGCCCTGCCACTCCCAATCTA
ATGTGGATATATTTGTTAATGTGGATGC

Sequence Annotation
Type Comment Oligos Coordinate Mutation Length Mutation
Insertion LoxP
Start: 92
End: 131
40
Expected:
Actual: GAATTCATAACTTCGTATAGCATACATTATACGAAGTTAT
Allele Issues

Are there any issues with this allele? : None reported

Targeting Vectors
Targeting Vector Intermediate Vector Report to Public
Ctpb1_5LoxP  
Back