Marker Symbol: Ikzf2 | MGI:1342541

History
Genomic Position

Assembly: GRCm38

Chromosome: 1

Strand -

Mutation Details

Mutation method: Targeted Mutation

Mutation type: Point Mutation

Mutation subtype: Point Mutation
Ikzf2 Tm1c long ssODN

Backbone:

Molecular Co-Ordinates
Feature Start End
Homology Arm
Genbank Files
Oligos Details
Sequence

TGACATGTCTAACCCTACCCATCTTTTTCCAGAGTTAAAACTAAACACTA
CAAGATAGTTACATCCTTGAACTAGAGAAAGTACCTGTCTGCTCCAGAGA
GCGATCGCATAACTTCGTATAGCATACATTATACGAAGTTATGGTTCTTC
CCTATAAAAAAAGTGTGAGTCCTTTTCTGTAGTATAAGAATAGCAATGCT
GCTACCTGCCCATGGGATGGTCAAATATGTATATACTCATAAAATGGTTG
AACTATCCAATGAAGCTCTCCTATACCTTTTGAACCTTTATCATATTATT
GCTATATTAAGAACTGTGGAAACGGAATCCCAAACTTCTTTCCTGACATG
CTATTCAGATTTGAGGCTGGAAGTCAAGACCCAGGCTACTTTCTGCTTCC
CAACAATCTCTTACTAGGAGAATTCTGAAGTCAAAGGTCACTTCCCATTG
CCACCCCTGAATAAAAAGGAAAGAGAATAGGTGTCAGGTAATATCAACAT
CAGACACCACAGGCAGTCATCAGGTTACGCGTTCAGCTGCTTACCAGTGT
GACTCCTTTTATGTACCATAAGCACATTGGGCCCAATGCAAACCATGCCA
CAGACGTCACATTTCAGTTTACCATTCGGAAGCCGGATTCCTCCCTCGCC
TTGAAGGTCCTGGACTTTCCTGTTGTCGGCCACCTCGCTGCTCTCAATTA
GGGGTTCTTCTAGGCTGCTCCCCTCATCGTGGCCCCTGATCTCATCCTCA
CGGCTCAGGGGCTGCCTGTCACACTCTTCATCACTCTGCATTTCCAGCTT
TACAGAATTTGCTGTGATTTAAAAGGAATTTAAAAACACTTGTTATTCTC
TGTAACCTCCACTTCTTTTCCGTCCACTGTCACTCTGCGGAATGGATGGA
AATGATACGCTAAGTCAATCCGTACTGTGTTCAATGCATAACTTCGTATA
GCATACATTATACGAAGTTATCGCCGGCGGCCCTTCACTTCTTCACAAGC
TCATTTGTTTCACTCAGCTCTGTGGCCTTTCTGCAGGTCATTAACTAAGT
CTTACATGTTTTTAAGTTTGCATTTTTAAAGTTAATAAGAATGAAAAGCA
TGTGCGG

Wildtype Oligos Sequence

Sequence Annotation
Type Comment Oligos Coordinate Mutation Length Mutation
Allele Issues

Are there any issues with this allele? : None reported

Targeting Vectors
Targeting Vector Intermediate Vector Report to Public
Ikzf2 Tm1c long ssODN  
Back