Marker Symbol: Fto | MGI:1347093

History
Genomic Position

Assembly: GRCm38

Chromosome: 8

Strand +

Mutation Details

Mutation method: Targeted Mutation

Mutation type: Point Mutation

Mutation subtype: Point Mutation
R313A

Backbone:

Molecular Co-Ordinates
Feature Start End
Homology Arm
Genbank Files
Oligos Details
Sequence

ATGACCTCAATGCCACCCACCAGCACTGTGTTTTGGCTGGCTCACAGCCT
CGGTTTAGTTCCACTCACGCTGTGGCAGAGGTAAGCAGAAATAAAAATGT
GATGATTCATGCTTAACTGAATGTGGCAGAGGTCGTTGGGTGGACAGTTT
ATTGTAGGGCTCCGAAGAGTAC

Wildtype Oligos Sequence

ATGACCTCAATGCCACCCACCAGCACTGTGTTTTGGCTGGCTCACAGCCT
CGGTTTAGTTCCACTCACCGTGTGGCAGAGGTAAGCAGAAATAAAAATGT
GATGATTCATGCTTAACTGAATGTGGCAGAGGTCGTTGGGTGGACAGTTT
ATTGTAGGGCTCCGAAGAGTAC

Sequence Annotation
Type Comment Oligos Coordinate Mutation Length Mutation
Substitution R313A
Start: 69
End: 70
2
Expected: CG
Actual: GC
Allele Issues

Are there any issues with this allele? : None reported

Targeting Vectors
Targeting Vector Intermediate Vector Report to Public
FTOdonor_1  
Back