Marker Symbol: Crb1 | MGI:2136343

History
Genomic Position

Assembly: GRCm38

Chromosome: 1

Strand -

Mutation Details

Mutation method: Targeted Mutation

Mutation type: Point Mutation

Mutation subtype: Point Mutation
Knock-in

Backbone:

Molecular Co-Ordinates
Feature Start End
Homology Arm
Genbank Files
Oligos Details
Sequence

AGCACTCATCAATGTTGATTTCACAGTGTGTCCCTGACCATCCCGAGAGA
CAGGCACACCGATAAGAACTGTAGCTGTCTTCACAGTTTCCTCCATGCAA
ACAGGGGCTGGAGTGGCAGGC

Wildtype Oligos Sequence

AGCACTCATCAATGTTGATTTCACAGTGTGTCCCTGACCATCCCGAGAGA
CAGGCACACCATAAGAACTGTAGCTGTCTTCACAGTTTCCTCCATGCAAA
CAGGGGCTGGAGTGGCAGGC

Sequence Annotation
Type Comment Oligos Coordinate Mutation Length Mutation
Insertion
Start: 61
End: 61
1
Expected:
Actual: G
Allele Issues

Are there any issues with this allele? : None reported

Targeting Vectors
Targeting Vector Intermediate Vector Report to Public
Crb1donor_1  
Back