Marker Symbol: Cdh23 | MGI:1890219

History
Genomic Position

Assembly: GRCm38

Chromosome: 10

Strand -

Mutation Details

Mutation method: Targeted Mutation

Mutation type: Point Mutation

Mutation subtype: Point Mutation

Backbone:

Molecular Co-Ordinates
Feature Start End
Homology Arm
Genbank Files
Oligos Details
Sequence

ATGGATCCTATCTTCATCAACCTGCCCTACTCTACTAACATCTACGAGCA
CTCTCCTCCGGTGAGCCCCGCCCCCAGCCCCAGAGCAGGAAGACAAATGC
CTGTCCTGCGTGGGTTCTCTA

Wildtype Oligos Sequence

ATGGATCCTATCTTCATCAACCTGCCCTACAGTACTAACATCTACGAGCA
CTCTCCTCCAGTGAGCCCCGCCCCCAGCCCCAGAGCAGGAAGACAAATGC
CTGTCCTGCGTGGGTTCTCTA

Sequence Annotation
Type Comment Oligos Coordinate Mutation Length Mutation
Substitution
Start: 31
End: 32
2
Expected: AG
Actual: TC
Substitution
Start: 60
End: 60
1
Expected: A
Actual: G
Allele Issues

Are there any issues with this allele? : None reported

Targeting Vectors
Targeting Vector Intermediate Vector Report to Public
Cdh23donorU1  
Back