Marker Symbol: Ap3m2 | MGI:1929214

History
Genomic Position

Assembly: GRCm38

Chromosome: 8

Strand -

Mutation Details

Mutation method: Targeted Mutation

Mutation type: Point Mutation

Mutation subtype: Point Mutation
L157P

Backbone:

Molecular Co-Ordinates
Feature Start End
Homology Arm
Genbank Files
Oligos Details
Sequence

TGCATCAAAGTACCAATTTGATTCTAGTTGACCAGTATTAATTGTTCCAG
GAAGCACCAACGTGGGGGACCAGCCTCCAACTGGGCAGCTGTCGGTGGTG
CCTTGGCGACGGACAGGGGTGAAATATACCAACAACGAGGCCTATTTCGA
TGTGGTGGAAGAGATAGACGCCATCATTGA

Wildtype Oligos Sequence

TGCATCAAAGTACCAATTTGATTCTAGTTGACCAGTATTAATTGTTCCAG
GAAGCACCAATGTGGGGGACCAGCTTCCAACTGGGCAGCTGTCGGTGGTG
CCTTGGCGACGGACAGGGGTGAAATATACCAACAACGAGGCCTATTTCGA
TGTGGTGGAAGAGATAGACGCCATCATTGA

Sequence Annotation
Type Comment Oligos Coordinate Mutation Length Mutation
Substitution
Start: 61
End: 61
1
Expected: T
Actual: C
Substitution L157P
Start: 75
End: 75
1
Expected: T
Actual: C
Allele Issues

Are there any issues with this allele? : None reported

Targeting Vectors
Targeting Vector Intermediate Vector Report to Public
Ap3m2donor12  
Back